Quick Order

Text Size:AAA

Human ACYP2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ACYP2 cDNA Clone Product Information
Gene_bank_ref_id:NM_138448.3
RefSeq ORF Size:300bp
cDNA Description:Full length Clone DNA of Homo sapiens acylphosphatase 2, muscle type.
Gene Synonym:ACYM, ACYP, ACYP2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ACYP2
Restriction Site:KpnI + XbaI (6.1kb + 0.3kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Degl'Innocenti,D. et al., 2004, IUBMB Life. 56 (1):29-33.
  • Gribenko A.V., et al., 2009, Proc. Natl. Acad. Sci. USA.106:2601-2606.
  • Yeung R.C., et al., 2006, Acta Crystallogr. F 62:80-82.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Size / Price
    Catalog: HG10437-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"