After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human KLK-7 transcript variant 1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KLK7 cDNA Clone Product Information
Gene_bank_ref_id:NM_005046.2
RefSeq ORF Size:762bp
cDNA Description:Full length Clone DNA of Homo sapiens kallikrein-related peptidase 7 (KLK7), transcript variant 1.
Gene Synonym:SCCE, PRSS6, KLK7
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-KLK7
Restriction Site:HindIII + XbaI (6.1kb + 0.76kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 34 T>C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Kallikrein-7, also known as kallikrein-related peptidase 7, Stratum corneum chymotryptic enzyme, Serine protease 6, KLK7, and PRSS6, is a secreted protein which belongs to the peptidase S1 family and Kallikrein subfamily. Members of the Kallikrein family are involved in various malignancies such as prostate (PSA, KLK2, KLK15), ovarian (KLK4, KLK5, KLK6, KLK8, KLK10), and breast cancer (KLK10, KLK13, KLK14). Kallikrein-7 / KLK7 appears to be increased in ovarian cancer and higher KLK7 expression in ovarian cancer tissue is associated with poorer prognosis of ovarian cancer patients. Kallikrein-7 / KLK7 is abundantly expressed in the skin and is expressed by keratinocytes in the epidermis. Kallikrein-7 / KLK7 is up-regulated in ovarian carcinoma, especially late-stage serous carcinoma, compared with normal ovaries and benign adenomas (at the protein level). It was significantly associated with shorter overall survival (OS) and disease-free survival (DFS). Kallikrein-7 / KLK7 may catalyze the degradation of intercellular cohesive structures in the cornified layer of the skin in the continuous shedding of cells from the skin surface. KLK7 also plays a role in the activation of precursors to inflammatory cytokines.

Size / Price
Catalog: HG10416-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"