After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CES2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CES2 cDNA Clone Product Information
Gene_bank_ref_id:NM_003869.4
RefSeq ORF Size:1872bp
cDNA Description:Full length Clone DNA of Homo sapiens carboxylesterase 2 (intestine, liver).
Gene Synonym:iCE, CE-2, PCE-2, CES2A1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CES2
Restriction Site:KpnI + XbaI (6.1kb + 1.87kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Carboxylesterase 2 (CES2) is a member of the carboxylesterase family and belongs to the multigene family. Carboxylesterase 2 is responsible for the hydrolysis of ester- and amide-bond-containing drugs such as cocaine and beroin. It also serves to hydrolyze long-chain fatty acid esters and thioesters. It is speculated that carboxylesterases may play a role in lipid metabolism and the blood-brain barrier system and together with isform 1, are a serine esterase involved in both drug metabolism and activation. Human carboxylesterase 2 is commonly expressed in tumor tissues and irinotecan, a topoisomerase I inhibitor commonly used in the treatment of many solid tumors.

References
  • Imai T. et al. (2006) Human carboxylesterase isozymes: catalytic properties and rational drug design. Drug metab pharmacokinet. 21 (3): 173-85.
  • Guang Xu, et al. (2002) Human carboxylesterase 2 is commonly expressed in tumor tissue and is correlated with activation of irinotecan. Clin Cancer Res. 8: 2605.
  • Zhang, et al. (2002) Comprehensive Evaluation of Carboxylesterase-2 Expression in Normal Human Tissues Using Tissue Array Analysis. Applied Immunohistochemistry & Molecular Morphology. 10 (4): 374-80.
  • Size / Price
    Catalog: HG10380-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"