Quick Order

Human AGTR1 / AT1 transcript variant 1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AGTR1 cDNA Clone Product Information
Gene_bank_ref_id:NM_000685.4
RefSeq ORF Size:1080bp
cDNA Description:Full length Clone DNA of Homo sapiens angiotensin II receptor, type 1, transcript variant 1.
Gene Synonym:AT1, AG2S, AT1B, AT1R, AT2R1, HAT1R, AGTR1A, AGTR1B, AT2R1A, AT2R1B
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-AGTR1-t1
Restriction Site:HindIII + XbaI (6.1kb + 1.08kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation: 573 T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human AGTR1 Gene Plasmid Map
Human AGTR1 / AT1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG10375-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"