After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MOG transcript variant alpha1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MOG cDNA Clone Product Information
NCBI RefSeq:NM_206809.2
RefSeq ORF Size:744bp
cDNA Description:Full length Clone DNA of Homo sapiens myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha1.
Gene Synonym:MOGIG-2, MGC26137
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Myelin oligodendrocyte glycoprotein (MOG) is a transmembrane protein belonging to immunoglobulin superfamily, and contains an Ig-like domain followed by two potential membrane-spanning regions. MOG is expressed only in the CNS with very low content (approximately 0.1% total proteins) in oligodendrogliocyte membrane. Three possible functions for MOG were suggested: (a) a cellular adhesive molecule, (b) a regulator of oligodendrocyte microtubule stability, and (c) a mediator of interactions between myelin and the immune system, in particular, the complement cascade. A direct interaction might exist between the membrane-associated regions of MOG and the myelin-specific glycolipid galactocerebroside (Gal-C), and such an interaction may have important consequences regarding the membrane topology and function of both molecules. It is considered that MOG is an autoantigen capable to produce a demyelinating multiple sclerosis-like disease in experimental animals.

References
  • Chekhonin VP, et al. (2003) Myelin oligodendrogliocyte glycoprotein: the structure, functions, role in pathogenesis of demyelinating disorders. Biomed Khim. 49(5): 411-23.
  • Hilton AA, et al. (1995) Characterization of cDNA and Genomic Clones Encoding Human Myelin Oligodendrocyte Glycoprotein. J Neurochem. 65(1): 309-18.
  • Johns TG, et al. (1999) The Structure and Function of Myelin Oligodendrocyte Glycoprotein. J Neurochem. 72(1): 1-9.
  • Size / Price
    Catalog: HG10364-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"