Quick Order

Human RBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RBP4cDNA Clone Product Information
cDNA Size:606
cDNA Description:ORF Clone of Homo sapiens retinol binding protein 4, plasma DNA.
Gene Synonym:RBP4
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Retinol-binding protein 4 (RBP4) is the specific carrier for retinol (also known as vitamin A), and is responsible for the conversion of unstable and insoluble retinol in aqueous solution into stable and soluble complex in plasma through their tight interaction. As a member of the lipocalin superfamily, RBP4 containing a β-barrel structure with a well-defined cavity is secreted from the liver, and in turn delivers retinol from the liver stores to the peripheral tissues. In plasma, the RBP4-retinol complex interacts with transthyretin (TTR), and this binding is crucial for preventing RBP4 excretion through the kidney glomeruli. RBP4 expressed from an ectopic source efficiently delivers retinol to the eyes, and its deficiency affects night vision largely. Recently, RBP4 as an adipokine, is found to be expressed in adipose tissue and correlated with obesity, insulin resistance (IR) and type 2 diabetes (T2DM).

  • Yang Q, et al. (2005) Serum retinol binding protein 4 contributes to insulin resistance in obesity and type 2 diabetes. Nature. 436(7049): 356-62.
  • Choi SH, et al. (2008) High plasma retinol binding protein-4 and low plasma adiponectin concentrations are associated with severity of glucose intolerance in women with previous gestational diabetes mellitus. J Clin Endocrinol Metab. 93(8): 3142-8.
  • Tepper BJ, et al. (2010) Serum retinol-binding protein 4 (RBP4) and retinol in a cohort of borderline obese women with and without gestational diabetes. Clin Biochem. 43(3): 320-3.