Quick Order

Human HSPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HSPB1cDNA Clone Product Information
Gene_bank_ref_id:NM_001540.3
cDNA Size:618
cDNA Description:ORF Clone of Homo sapiens heat shock 27kDa protein 1 DNA.
Gene Synonym:CMT2F, HMN2B, HSP27, HSP28, Hsp25, SRP27, HS.76067
Species:Human
Vector:pCMV3-untagged
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human HSPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human HSPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10351-ACG$325
Human HSPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10351-ACR$325
Human HSPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10351-ANG$325
Human HSPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10351-ANR$325
Human HSPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10351-CF$295
Human HSPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10351-CH$295
Human HSPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10351-CM$295
Human HSPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10351-CY$295
Human HSPB1 Gene cDNA Clone (full-length ORF Clone)HG10351-M$95
Human HSPB1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10351-M-F$295
Human HSPB1 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10351-M-N$295
Human HSPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10351-NF$295
Human HSPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10351-NH$295
Human HSPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10351-NM$295
Human HSPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10351-NY$295
Human HSPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10351-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:HG10351-UT
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 business days
Images
  • Human HSPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"