After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GranzymeH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GZMHcDNA Clone Product Information
cDNA Size:741
cDNA Description:ORF Clone of Homo sapiens granzyme H (cathepsin G-like 2, protein h-CCPX) DNA.
Gene Synonym:CCP-X, CGL-2, CSP-C, CTLA1, CTSGL2
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human GranzymeH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name

Granzymes are key components of the immune response that play important roles in eliminating host cells infected by intracellular pathogens. Several granzymes are potent inducers of cell death. A total of eight granzymes (A-G and M) have been identified in the mouse, but only five are known in humans (A, B, H, M and granzyme 3), and granzyme H appears to be specifically human. Human granzyme H is a neutral serine protease that is expressed predominantly in the lymphokine-activated killer (LAK)/natural?killer (NK) compartment of the immune system. In adenovirus-infected cells in which granzyme B (gzmB) and downstream apoptosis pathways are inhibited, granzyme H directly cleaves the adenovirus DNA-binding protein (DBP), a viral component absolutely required for viral DNA replication. This virus demonstrated that gzmH directly induces an important decay in viral DNA replication. Interestingly, gzmH also cleaves the adenovirus 100K assembly protein, a major inhibitor of gzmB, and relieves gzmB inhibition. Granzyme H has a very high amino acid identity (>90%) with many portions of the granzyme B sequence, particularly near the amino terminus of the molecule despite performing a distinct enzymic function.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 business days
  • Human GranzymeH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items