After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human GranzymeB natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GZMB cDNA Clone Product Information
Gene_bank_ref_id:NM_004131.3
RefSeq ORF Size:744bp
cDNA Description:Full length Clone DNA of Homo sapiens granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1).
Gene Synonym:HLP, CCPI, CGL1, CSPB, SECT, CGL-1, CSP-B, CTLA1, CTSGL1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-GZMB
Restriction Site:KpnI + XbaI (6.1kb + 0.74kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the 321C/T mutation not resulting in amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Granzyme B, also known as GZMB, is the most prominent member of the granzyme family of cell death-inducing serine proteases expressed in the granules of cytotoxic T lymphocytes (CTLs) and NK cells. Granzyme B enters the target cells depending on another membrane-binding granule protein, perforin, results in the activation of effector caspases and mitochondrial depolarization through caspase-dependent and -independent pathways, and consequently induces rapid cell apoptosis. Over 30 substrates of GZMB have been identified including the key substrate caspase-3, ICAD and Bid. GZMB is suggested to protect the host by lysing cells bearing on their surface 'nonself' antigens such as bacterial and viral infected-cells and tumor cells, and accordingly plays an essential role in immunosurveillance.

Size / Price
Catalog: HG10345-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"