Quick Order

Human SLPI natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human SLPI cDNA Clone Product Information
NCBI RefSeq:NM_003064.2
RefSeq ORF Size:399bp
cDNA Description:Full length Clone DNA of Homo sapiens secretory leukocyte peptidase inhibitor.
Gene Synonym:ALP, MPI, ALK1, BLPI, HUSI, WAP4, WFDC4, HUSI-I
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-SLPI
Restriction Site:KpnI + XbaI (6.1kb + 0.4kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human SLPI Gene Plasmid Map
Human SLPI Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Secretory leukoprotease inhibitor (SLPI), also called antileukoprotease (ALP), is a 12-kDa, nonglycosylated serine protease inhibitor present in mucous secretions. It is thought to play a role in protecting the mucosae from injury associated with inflammation. SLPI is locally produced by serous cells, including bronchial submucosal glands. Elafin and SLPI are members of larger families of proteins secreted predominantly at mucosal sites, and have been shown to be modulated in multiple pathological conditions. Elafin and SLPI are structurally related in that both have a fold with a four-disulfide core or whey acidic protein (WAP) domain responsible for inhibiting proteases. SLPI is a prominent innate immune protein of the respiratory tract, possessing serine protease inhibitor activity, antibacterial activity, and anti-inflammatory/immunomodulatory activity.

References
  • Moreau T, et al. (2008) Multifaceted roles of human elafin and secretory leukocyte proteinase inhibitor (SLPI), two serine protease inhibitors of the chelonianin family. Biochimie. 90(2): 284-95.
  • Weldon S, et al. (2007) Innate host defense functions of secretory leucoprotease inhibitor. Exp Lung Res. 33(10): 485-91.
  • Williams SE, et al. (2006) SLPI and elafin: one glove, many fingers. Clin Sci (Lond). 110(1): 21-35.
  • Kikuchi T, et al. (1996) Regulation of secretory leukoprotease inhibitor gene expression. Nihon Rinsho. 54(2): 405-10.
  • Size / Price
    Catalog: HG10343-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"