Quick Order

Text Size:AAA

Human IDS / MPS2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IDScDNA Clone Product Information
Gene_bank_ref_id:NM_000202.5
cDNA Size:1653
cDNA Description:ORF Clone of Homo sapiens iduronate 2-sulfatase, transcript variant 1 DNA.
Gene Synonym:MPS2, SIDS
Species:Human
Vector:pCMV3-untagged
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human IDS / MPS2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human IDS / MPS2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10337-ACG$345
Human IDS / MPS2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10337-ACR$345
Human IDS / MPS2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10337-CF$315
Human IDS / MPS2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10337-CH$315
Human IDS / MPS2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10337-CM$315
Human IDS / MPS2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10337-CY$315
Human IDS / MPS2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10337-M$115
Human IDS / MPS2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10337-M-N$315
Human IDS / MPS2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10337-NF$315
Human IDS / MPS2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10337-NH$315
Human IDS / MPS2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10337-NM$315
Human IDS / MPS2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10337-NY$315
Human IDS / MPS2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10337-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Iduronate 2-Sulfatase, also known as IDS, is a member of the highly conserved sulfatase family of enzymes that catalyze the hydrolysis of O- and N-sulfate esters from a variety of substrates. The human Iduronate 2-Sulfatase/IDS consists of a signal peptide, a pro peptide and a mature chain that may be further processed into two chains. Among the identified 18 human sulfatases, Iduronate 2-Sulfatase/IDS is required for the lysosomal degradation of the glycosaminoglycans (GAG), heparan sulfate and dermatan sulfate. Multiple mutations in this X-chromosome localized gene result in Iduronate 2-Sulfatase/IDS enzymatic deficiency, and lead to the sex-linked Mucopolysaccharidosis Type II (MPS II ), also known as Hunter Syndrome characterized by the lysosomal accumulation of the GAG and their excretion in urine. MPS II has a wide spectrum of clinical manifestations ranging from mild to severe due to the level of Iduronate 2-Sulfatase/IDS enzyme. Retroviral-mediated Iduronate 2-Sulfatase/IDS gene transfer into lymphoid cells would be a promising gene therapeutic strategy.

Size / Price
Catalog:HG10337-UT
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability5 business days
Images
  • Human IDS / MPS2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"