Quick Order

Human CD50 / ICAM3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ICAM3cDNA Clone Product Information
cDNA Size:1644
cDNA Description:ORF Clone of Homo sapiens intercellular adhesion molecule 3 DNA.
Gene Synonym:CD50, CDW50, ICAM-R
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human CD50 / ICAM3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name

The protein ICAM-3, also known as CD50, is a member of the intercellular adhesion molecule (ICAM) family consisting three members. It is a DC-SIGN ligand that is constitutively expressed on resting leukocytes, and is thus an important molecule for the first immune response. ICAM-3 comprises of five immunoglobulin-like domains, and binds LFA-1 through its two N-terminal domains. It functions not only as an adhesion molecule, but also as a potent signalling molecule. ICAM-3 binds to LFA-1 on antigen-presenting cells (APC) stabilizing the T cell-APC interaction, facilitating signaling through the CD3/TCR complex. However, recent evidence using cultured and transformed T cells suggests ICAM-3 may also function in signaling. It has been reported that CD50 molecule can play a role in developing functionally mature T lymphocytes and its expression increases during the maturation process of T lymphocytes. In addition, the interactions of ICAM-3 and LFA-1 facilitate HIV-1- induced virological synapse formation between T cells. ICAM-3 is associated with an increase of cellular radio-resistance and cancer cell proliferation. It could be considered as a candidate for anti-cancer drug development and as a cancer diagnostic marker.

  • Berney SM, et al. (1999) ICAM-3 (CD50) cross-linking augments signaling in CD3-activated peripheral human T lymphocytes. J Leukoc Biol. 65(6): 867-74.
  • van Buul JD, et al. (2004) ICAM-3 activation modulates cell-cell contacts of human bone marrow endothelial cells. J Vasc Res. 41(1): 28-37.
  • Sugino H. (2005) ICAM-3, a ligand for DC-SIGN, was duplicated from ICAM-1 in mammalian evolution, but was lost in the rodent genome. FEBS Lett. 579(13): 2901-6.
  • Park JK, et al. (2010) ICAM-3 enhances the migratory and invasive potential of human non-small cell lung cancer cells by inducing MMP-2 and MMP-9 via Akt and CREB. Int J Oncol. 36(1): 181-92.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human CD50 / ICAM3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    • Human CD50 / ICAM3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items