Quick Order

Text Size:AAA

Human GNS / G6S natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GNS cDNA Clone Product Information
NCBI RefSeq:NM_002076.3
RefSeq ORF Size:1659bp
cDNA Description:Full length Clone DNA of Homo sapiens glucosamine (N-acetyl)-6-sulfatase.
Gene Synonym:G6S, MGC21274
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-GNS
Restriction Site:KpnI + XbaI (6.1kb + 1.66kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human GNS Gene Plasmid Map
Human GNS / G6S Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Glucosamine (N-acetyl)-6-sulfatase (GNS), also known as G6S, a hydrolase, which is one of the enzymes involved in heparan sulfate catabolism leading to lysosomal storage. GNS is required for the catabolism of the glycosaminoglycans (GAG) including heparin, heparan sulphate, and keratan sulphate through the hydrolysis of 6-sulfate group from the N-acetyl-D-glucosamine 6-sulfate units. Mucopolysaccharidosis type IIID (MPS IIID) is the least common of the four subtypes of Sanfilippo syndrome. It is caused by a deficiency of N-acetylglucosamine-6-sulphatase. A mutation in GNS resulting in MPS IIID indicates the potential utility of molecular diagnosis for this rare condition. As the least common type of the four subtypes of Sanfilippo syndrome, MPS IIID has profound mental deterioration, hyperactivity, and relatively mild somatic manifestations.

References
  • Fuchs W, et al. (1985) Intralysosomal formation and metabolic fate of N-acetylglucosamine 6-sulfate from keratan sulfate. Eur J Biochem. 151(3): 551-6.
  • Beesley CE, et al. (2003) Sanfilippo syndrome type D: identification of the first mutation in the N-acetylglucosamine-6-sulphatase gene. J Med Genet. 40(3): 192-4.
  • Mok A, et al. (2003) Genomic basis of mucopolysaccharidosis type IIID (MIM 252940) revealed by sequencing of GNS encoding N-acetylglucosamine-6-sulfatase. Genomics. 81(1): 1-5.
  • Elioglu NH, et al. (2009) A novel loss-of-function mutation in the GNS gene causes Sanfilippo syndrome type D. Genet Couns. 20(2): 133-9.
  • Size / Price
    Catalog: HG10319-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"