Quick Order

Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
POSTNcDNA Clone Product Information
cDNA Size:2256
cDNA Description:ORF Clone of Homo sapiens periostin, osteoblast specific factor, transcript variant 4 DNA.
Gene Synonym:Pn, OSF-2, PDLPOSTN, MGC119510, MGC119511, periostin, RP11-412K4.1
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10299-ACG$345
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10299-ACR$345
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10299-CF$315
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10299-CH$315
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10299-CM$315
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10299-CY$315
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone)HG10299-G$195
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10299-G-F$445
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10299-G-N$445
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10299-NF$315
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10299-NH$315
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10299-NM$315
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10299-NY$315
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10299-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Periostin ( POSTN ), also known as OSF2 (osteoblast specific factor 2), is a heterofunctional secreted extracellular matrix (ECM) protein comprised of four fasciclin domains that promotes cellular adhesion and movement, as well as collagen fibrillogenesis. Postn is expressed in unique growth centers during embryonic development where it facilitates epithelial-mesenchymal transition (EMT) of select cell populations undergoing reorganization. In the adult, Postn expression is specifically induced in areas of tissue injury or areas with ongoing cellular re-organization. In the adult heart Postn is induced in the ventricles following myocardial infarction, pressure overload stimulation, or generalized cardiomyopathy. Although the detailed function of Postn is still unclear, Postn-integrin interaction is thought to be involved in tumor development. Postn is frequently overexpressed in various types of human cancers, stimulating metastatic growth by promoting cancer cell survival, invasion and angiogenesis, and can be a useful marker to predict the behavior of cancer.

  • Kudo,Y. et al., 2007, Histol Histopathol. 22 (10):1167-1174.
  • Li, J.S. et al., 2007, World J Gastroenterol. 13 (39): 5261-5266.
  • Oku, E. et al., 2008, Int J Hematol. 88 (1): 57-63.
  • Hamilton, D.W. et al., 2008, J Cell Commun Signal. 2(1-2):9-17.
  • Puglisi, F.J et al., 2008, Clin Pathol. 61 (4): 494-498.
  • Conway, S. J. et al., 2008, Curr Genomics. 9 (8): 548-555.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items