After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human SerpinD1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SERPIND1 cDNA Clone Product Information
NCBI RefSeq:NM_000185.3
RefSeq ORF Size:1500bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade D (heparin-cofactor), member 1.
Gene Synonym:SerpinD1, HC2, LS2, HCF2, HCII, HLS2, D22S673
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-SerpinD1
Restriction Site:KpnI + XbaI (6.1kb + 1.5kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for a point mutation 1446 T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human SERPIND1 Gene Plasmid Map
Human SerpinD1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

SerpinD1, also known as heparin cofactor II (HCâ…¡), is a member of Serpin superfamily of the serine proteinase inhibitors. HCII is a glycoprotein in human plasma that inhibits thrombin and chymotrypsin, and the rate of inhibition of thrombin is rapidly increased by Dermatan sulfate (DS), heparin (H) and glycosaminoglycans(GAG). The stimulatory effect of glycosaminoglycans on the inhibition is mediated, in part, by the N-terminal acidic domain of HCII. Interestingly, a C-terminal His-tagged recombinant HCII exhibits enhanced activity of thrombin inhibition. It has been suggested that HCII plays an unique and important role in vascular homeostasis, and accordingly mutations in this gene or congenital HCII deficiency is potentially associated with thrombosis. HCII specifically inhibits thrombin action at the site of vascular wall injury and HCII-thrombin complexes have been detected in human plasma. HCII protects against thrombin-induced vascular remodeling in both humans and mice and suggest that HCII is a predictive biomarker and therapeutic target for atherosclerosis. SerpinD1 also inhibits chymotrypsin, but in a glycosaminoglycan-independent manner.

References
  • Rau JC, et al. (2009) Heparin cofactor II in atherosclerotic lesions from the Pathobiological Determinants of Atherosclerosis in Youth (PDAY) study. Exp Mol Pathol. 87(3): 178-83.
  • Aihara K, et al. (2009) Heparin cofactor II as a novel vascular protective factor against atherosclerosis. J Atheroscler Thromb. 16(5): 523-31.
  • Size / Price
    Catalog: HG10295-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"