Quick Order

Human Angiopoietin-4 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ANGPT4 cDNA Clone Product Information
Gene_bank_ref_id:NM_015985.2
RefSeq ORF Size:1512bp
cDNA Description:Full length Clone DNA of Homo sapiens angiopoietin 4.
Gene Synonym:AGP4, ANG4, ANG-3, MGC138181, MGC138183
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ANGPT4
Restriction Site:KpnI + XbaI (6.1kb + 1.51kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 12 G>A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
References
  • Grosios K, et al. (1999) Assignment of ANGPT4, ANGPT1, and ANGPT2 encoding angiopoietins 4, 1 and 2 to human chromosome bands 20p13, 8q22.3?q23 and 8p23.1, respectively, by in situ hybridization and radiation hybrid mapping. Cytogenet. Cell Genet. 84 (1-2): 118-20.
  • Yamakawa M, et al. (2004) Expression of angiopoietins in renal epithelial and clear cell carcinoma cells: regulation by hypoxia and participation in angiogenesis. Am J Physiol Renal Physiol. 287 (4): 649-57.
  • Oliner J, et al. (2004) Suppression of angiogenesis and tumor growth by selective inhibition of angiopoietin-2. Cancer Cell. 6 (5): 507-16.
  • Size / Price
    Catalog: HG10293-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"