Quick Order

Human Matriptase / ST14 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ST14 cDNA Clone Product Information
Gene_bank_ref_id:NM_021978.3
RefSeq ORF Size:2568bp
cDNA Description:Full length Clone DNA of Homo sapiens suppression of tumorigenicity 14 (colon carcinoma).
Gene Synonym:HAI, MT-SP1, MTSP-1, MTSP1, PRSS14, SNC19, TADG-15
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ST14
Restriction Site:KpnI + XbaI (6.1kb + 2.57kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1215C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG10284-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"