After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human PDGF-D transcript variant 1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PDGFD cDNA Clone Product Information
Gene_bank_ref_id:NM_025208.4
RefSeq ORF Size:1113bp
cDNA Description:Full length Clone DNA of Homo sapiens platelet derived growth factor D (PDGFD), transcript variant 1.
Gene Synonym:PDGFD, IEGF, MGC26867, MSTP036, SCDGF-B.
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PDGFD
Restriction Site:KpnI + XbaI (6.1kb + 1.11kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Background

Platelet-derived growth factor D (PDGF-D), also known as Iris-expressed growth factor, is a member of the PDGF/vascular endothelial growth factor family. The four members of this family are mitogenic factors for cells of mesenchymal origin and are characterized by a core motif of eight cysteines, seven of which are found in this factor. PDGF-D/PDGFD only forms homodimers and, therefore, does not dimerize with the other three family members. It differs from alpha and beta members of this family in having an unusual N-terminal domain, the CUB domain. The expression of PDGF-D/PDGFD in the eye is tissue-specific. In the anterior segment, it is localized to iris and ciliary body, whereas in the retina, PDGF-D/PDGFD is restricted to the outer plexiform layer. PDGF-D/PDGFD is present in aqueous humor but is not detectable in mature lens or in mouse lens-derived alphaTN4-1 cells. PDGF-D/PDGFD is highly expressed in human breast cancer and facilitates tumor growth and lymph node metastasis, making it a potential target in breast cancer. PDGF-D/PDGFD increases drug delivery and hence improves the efficacy of chemotherapy through vessel normalization. Intervention in the PDGF-D pathway in the eye, perhaps by antibody or blocking peptide, could be useful in the treatment of certain cataracts, including post-operative secondary cataract.

References
  • Ray S, et al. (2005) Platelet-derived growth factor D, tissue-specific expression in the eye, and a key role in control of lens epithelial cell proliferation. J Biol Chem. 280(9): 8494-502.
  • Uutela M, et al. (2004) PDGF-D induces macrophage recruitment, increased interstitial pressure, and blood vessel maturation during angiogenesis. Blood. 104 (10): 3198-204.
  • Taneda S, et al. (2004) Obstructive uropathy in mice and humans: potential role for PDGF-D in the progression of tubulointerstitial injury. J Am Soc Nephrol. 14 (10): 2544-55.
  • Size / Price
    Catalog: HG10281-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"