After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PDGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PDGFCcDNA Clone Product Information
cDNA Size:1038
cDNA Description:ORF Clone of Homo sapiens platelet derived growth factor C DNA.
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human PDGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human PDGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10273-ACG$325
Human PDGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10273-ACR$325
Human PDGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10273-ANG$325
Human PDGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10273-ANR$325
Human PDGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10273-CF$295
Human PDGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10273-CH$295
Human PDGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10273-CM$295
Human PDGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10273-CY$295
Human PDGF-C Gene cDNA Clone (full-length ORF Clone)HG10273-M$95
Human PDGF-C Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10273-M-F$295
Human PDGF-C Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10273-M-N$295
Human PDGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10273-NF$295
Human PDGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10273-NH$295
Human PDGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10273-NM$295
Human PDGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10273-NY$295
Human PDGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10273-UT$295
 Learn more about expression Vectors

PDGF-C is a member of the PDGF/VEGF family of growth factors with a unique domain organization and expression pattern. Platelet-derived growth factor receptors (PDGFRs) are catalytic receptors that have intracellular tyrosine kinase activity. They have roles in the regulation of many biological processes including embryonic development, angiogenesis, cell proliferation and differentiation, and contribute to the pathophysiology of some diseases, including cancer. There are two isoforms of the PDGFR receptor; PDGFRalpha and PDGFRbeta, which can form homo- or heterodimers. The endogenous PDGFR ligands are PDGF-A, -B, -C and -D, which induce receptor dimerization and transphosphorylation at specific tyrosine residues upon binding. This activates the intracellular kinase activity, initiating intracellular signaling through the MAPK, PI 3-K and PKCgamma pathways. PDGF-C acts as a specific ligand for alpha platelet-derived growth factor receptor homodimer, and alpha and beta heterodimer. Binding of this growth factor to its affinity receptor elicits a variety of cellular responses. PDGF-C Appears to be involved in the three stages of wound healing: inflammation, proliferation and remodeling. Involved in fibrotic processes, in which transformation of interstitial fibroblasts into myofibroblasts plus collagen deposition occurs.

  • Li X, et al. (2000) PDGF-C is a new protease-activated ligand for the PDGF alpha-receptor. Nat Cell Biol. 2 (5): 302-9.
  • Ding H, et al. (2004) A specific requirement for PDGF-C in palate formation and PDGFR-alpha signaling. Nat Genet. 36 (10): 1111-6.
  • Choi SJ, et al. (2009) The PDGF-C regulatory region SNP rs28999109 decreases promoter transcriptional activity and is associated with CL/P. European Journal of Human Genetics. 17 (11): 774-84.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items