Quick Order

Human FCGR2B / CD32b transcript variant 2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FCGR2B cDNA Clone Product Information
NCBI RefSeq:NM_001002273.1
RefSeq ORF Size:873bp
cDNA Description:Full length Clone DNA of Homo sapiens Fc fragment of IgG, low affinity IIb, receptor (FCGR2B), transcript variant 2.
Gene Synonym:FCGR2B, CD32, FCG2, CD32B, FCGR2, IGFR2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-FCGR2B
Restriction Site:KpnI + XbaI (6.1kb + 0.87kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG10260-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"