Quick Order

Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FCGR2BcDNA Clone Product Information
cDNA Size:876
cDNA Description:ORF Clone of Homo sapiens Fc fragment of IgG, low affinity IIb, receptor (CD32), transcript variant 3 DNA.
Gene Synonym:FCGR2B, CD32, FCG2, CD32B, FCGR2, IGFR2
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 336 G/A not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10259-ACG$325
Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10259-ACR$325
Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10259-CF$295
Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10259-CH$295
Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10259-CM$295
Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10259-CY$295
Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone)HG10259-M$95
Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10259-M-F$295
Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10259-M-N$295
Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10259-NF$295
Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10259-NH$295
Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10259-NM$295
Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10259-NY$295
Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10259-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 business days
  • Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items