Quick Order

Human LY96 / MD-2 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human LY96 cDNA Clone Product Information
NCBI RefSeq:NM_015364.2
RefSeq ORF Size:483bp
cDNA Description:Full length Clone DNA of Homo sapiens lymphocyte antigen 96.
Gene Synonym:LY96, MD2, MD-2
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

LY-96, also known as ESOP-1, is a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS). LY-96 also cooperates with TLR2 in the response to cell wall components from Gram-positive and Gram-negative bacteria. It enhances TLR4-dependent activation of NF-kappa-B. ESOP-1 has 160 amino acids, the sequence of which shows 64% identity with human ESOP-1/MD-2. ESOP-1 mRNA is highly expressed in the mouse embryos at 7.5 days after coitus.

Size / Price
Catalog: HG10243-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeks
 Shipping instructions
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"