Quick Order

Human CCL19 / MIP-3b natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CCL19 cDNA Clone Product Information
NCBI RefSeq:NM_006274.2
RefSeq ORF Size:297bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 19.
Gene Synonym:ELC, CKb11, MIP3B, MIP-3b, SCYA19, MGC34433
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CCL19
Restriction Site:KpnI + XbaI (6.1kb + 0.3kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CCL19 Gene Plasmid Map
Human CCL19 / MIP-3b Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Size / Price
Catalog: HG10232-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"