Quick Order

Text Size:AAA

Human MASP1 / MASP3 transcript variant 2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MASP1 cDNA Clone Product Information
Gene_bank_ref_id:NM_139125.2
RefSeq ORF Size:2187bp
cDNA Description:Full length Clone DNA of Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor), transcript variant 2.
Gene Synonym:MASP1, MASP, RaRF, CRARF, PRSS5, CRARF1, FLJ26383, MGC126283, MGC126284, DKFZp686I01199.
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-MASP1
Restriction Site:KpnI + XbaI (6.1kb + 2.19kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation: 1374 T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG10223-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"