Quick Order

Human NFkB1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NFKB1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001165412.1
RefSeq ORF Size:2907bp
cDNA Description:Full length Clone DNA of Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1).
Gene Synonym:NFKB1, KBF1, EBP-1, MGC54151, NFKB-p50, NFKB-p105, NF-kappa-B, DKFZp686C01211
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-NFKB1
Restriction Site:KpnI + NotI (6.1kb + 2.91kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1140 T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human NFKB1 Gene Plasmid Map
Human NFkB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG10212-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"