Quick Order

Human JAM-A natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human F11R cDNA Clone Product Information
Gene_bank_ref_id:NM_016946.4
RefSeq ORF Size:900bp
cDNA Description:Full length Clone DNA of Homo sapiens F11 receptor (F11R).
Gene Synonym:JAM, F11R, KAT, JAM1, JAMA, JCAM, CD321, JAM-1, JAM-A, PAM-1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-F11R
Restriction Site:KpnI + XbaI (6.1kb + 0.9kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human F11R Gene Plasmid Map
Human JAM-A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Junctional adhesion molecule-A (JAM-A), also known as F11 receptor (F11R) or Cluster of Differentiation 321 (CD321), is a transmembrane protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. JAM-A protein serves as a serotype-independent receptor for mammalian orthoreoviruses (reoviruses). It is also a ligand for the integrin LFA1, involves in leukocyte transmigration. As a cell adhesion molecule of the immunoglobulin superfamily, JAM-A protein involves in platelet adhesion, secretion and aggregation, and plays a crucial role in inflammatory thrombosis and atherosclerosis. In addition, it may be a potential therapeutic target for breast cancer.

References
  • Guglielmi KM, et al. (2007) Reovirus binding determinants in junctional adhesion molecule-A. J Biol Chem. 282(24): 17930-40.
  • Yeung D, et al. (2008) Decreased junctional adhesion molecule-A expression during blood-brain barrier breakdown. Acta Neuropathol. 115(6): 635-42.
  • Ong KL, et al. (2009) Elevated plasma level of soluble F11 receptor/junctional adhesion molecule-A (F11R/JAM-A) in hypertension. Am J Hypertens. 22(5): 500-5.
  • Size / Price
    Catalog: HG10198-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"