Quick Order

Human PROK1 / EG-VEGF natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PROK1 cDNA Clone Product Information
Gene_bank_ref_id:NM_032414.2
RefSeq ORF Size:318bp
cDNA Description:Full length Clone DNA of Homo sapiens prokineticin 1.
Gene Synonym:PROK1, PK1, PRK1, EGVEGF
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PROK1
Restriction Site:HindIII + XbaI (6.1kb + 0.32kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PROK1 Gene Plasmid Map
Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

EG-VEGF, also known as prokineticin-1, is a member of the AVIT (prokineticin) family. Prokineticins are secreted proteins that can promote angiogenesis and induce strong gastrointestinal smooth muscle contraction. EG-VEGF can be detected in the steroidogenic glands, ovary, testis, adrenal and placenta. EG-VEGF has little or no effect on a variety of other endothelial and non-endothelial cell types. It induces proliferation, migration and fenestration (the formation of membrane discontinuities) in capillary endothelial cells derived from endocrine glands. It directly influences neuroblastoma progression by promoting the proliferation and migration of neuroblastoma cells. EG-VEGF may play a role in placentation. It may also function in normal and pathological testis angiogenesis. It positively regulates PTGS2 expression and prostaglandin synthesis.

References
  • Masuda Y, et al. (2002) Isolation and identification of EG-VEGF/prokineticins as cognate ligands for two orphan G-protein-coupled receptors. Biochem. Biophys. Res. Commun. 293 (1): 396-402.
  • Pasquali D. et al. (2006) The endocrine-gland-derived vascular endothelial growth factor (EG-VEGF)/prokineticin 1 and 2 and receptor expression in human prostate: Up-regulation of EG-VEGF/prokineticin 1 with malignancy. Endocrinology. 147 (9): 4245-51.
  • Ngan ES, et al. (2008) Prokineticin-1 (Prok-1) works coordinately with glial cell line-derived neurotrophic factor (GDNF) to mediate proliferation and differentiation of enteric neural crest cells. Biochim Biophys Acta. 1783 (3): 467-78.
  • Ngan ES, et al. (2007) Prokineticin-1 modulates proliferation and differentiation of enteric neural crest cells. Biochim Biophys Acta. 1773 (4): 536-45.
  • Size / Price
    Catalog: HG10183-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"