Quick Order

Text Size:AAA

Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CNDP2cDNA Clone Product Information
cDNA Size:1428
cDNA Description:ORF Clone of Homo sapiens CNDP dipeptidase 2 (metallopeptidase M20 family) DNA.
Gene Synonym:CNDP2, CN2, CPGL, PEPA, HsT2298, FLJ10830
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 105G/A and 570 T/C that do not cause any amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10168-ACG$325
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10168-ACR$325
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10168-ANG$325
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10168-ANR$325
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10168-CF$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10168-CH$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10168-CM$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10168-CY$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone)HG10168-M$95
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10168-M-N$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10168-NF$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10168-NH$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10168-NM$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10168-NY$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10168-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Mouse cytosolic non-specific dipeptidase, also known as CNDP dipeptidase 2, Glutamate carboxypeptidase-like protein 1, Peptidase A, CNDP2 and CN2, is a cytoplasm protein which belongs to the peptidase M20A family. CNDP2 / CPGL is a cytosolic enzyme that can hydrolyze carnosine to yield l-histidine and beta-alanine. CNDP2 / CPGL hydrolyzes a variety of dipeptides including L-carnosine but has a strong preference for Cys-Gly. It may be play a role as tumor suppressor in hepatocellular carcinoma (HCC) cells. Isoform 1 of CNDP2 / CPGL is ubiquitously expressed with higher levels in kidney and liver (at protein level). Isoform 2 of CNDP2 / CPGL is expressed in fetal tissues, it is only expressed in adult liver and placental tissues. CNDP2 / CPGL is highly expressed in the histaminergic neurons in the tuberomammillary nucleus, implying that it may supply histidine to histaminergic neurons for histamine synthesis.

  • Bakker,SJ. et al., 2008, Diabetes  57 (12):e16; author reply e17. 
  • Wanic, K. et al., 2008, Diabetes  57 (9): 2547-51.
  • McDonough,CW. et al., 2009, Hum Genet 126 (2): 265-75.
  • Kaur,H. et al., 2009, J Biol Chem. 284 (21):14493-502.