Quick Order

Text Size:AAA

Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AGGF1cDNA Clone Product Information
cDNA Size:2145
cDNA Description:ORF Clone of Homo sapiens angiogenic factor with G patch and FHA domains 1(AGGF1) DNA.
Gene Synonym:AGGF1, VG5Q, GPATC7, GPATCH7, FLJ10283, HSU84971, HUS84971
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10162-ACG$345
Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10162-ACR$345
Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10162-ANG$345
Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10162-ANR$345
Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10162-CF$315
Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10162-CH$315
Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10162-CM$315
Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10162-CY$315
Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone)HG10162-M$115
Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10162-M-N$345
Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10162-NF$315
Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10162-NH$315
Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10162-NM$315
Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10162-NY$315
Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10162-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability5 business days
  • Human AGGF1 / VG5Q Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items