Quick Order

Text Size:AAA

Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL1RAPL2cDNA Clone Product Information
Gene_bank_ref_id:NM_017416.1
cDNA Size:2067
cDNA Description:ORF Clone of Homo sapiens interleukin 1 receptor accessory protein-like 2 (IL1RAPL2) DNA.
Gene Synonym:IL1RAPL2, IL1R9, IL-1R9, TIGIRR-1, IL1RAPL-2
Species:Human
Vector:pCMV3-untagged
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10156-ACG$345
Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10156-ACR$345
Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10156-CF$315
Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10156-CH$315
Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10156-CM$315
Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10156-CY$315
Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone)HG10156-M$115
Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10156-M-F$345
Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10156-M-N$345
Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10156-NF$315
Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10156-NH$315
Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10156-NM$315
Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10156-NY$315
Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10156-UT$315
 Learn more about expression Vectors
IL-1 Family & Receptor Related Products
Product nameProduct name
Canine IL1R2 / IL1RB Protein (Fc Tag)Rat IL18R1 Protein (His Tag)Mouse IL36G / IL1F9 Protein (His Tag)Cynomolgus IL18R1 Protein (Fc Tag)Rabbit IL-1 beta / IL1B ProteinHuman p38 alpha / MAPK14 Protein (Activated in vitro, His Tag)Human IL18 / IL-18 ProteinCanine IL18R1 Protein (ECD, His Tag)Human IL1RL2 / IL-1Rrp2 Protein (Fc Tag)Cynomolgus IL18R1 Protein (His Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human p38 alpha / MAPK14 Protein (His Tag)Human IL1RL1 / DER4 Protein (Fc Tag)Human IL1RL1 / ST2 Protein (His Tag)Human IL1RL1 / DER4 ProteinHuman IL1R2 / CD121b Protein (Fc Tag)Human IL1R2 / IL1RB / CD121b Protein (His Tag)Human IL1R2 / IL1RB / CD121b ProteinHuman IL18 / Interleukin 18 / IGIF Protein (GST Tag)Human IL-1RAcP / IL-1R3 Protein (His & Fc Tag)Human IL-1RAcP / IL-1R3 Protein (His Tag)Human IL-1RA / IL1RN Protein (Fc Tag)Human IL-1RA / IL1RN ProteinHuman IL36G / IL1F9 Protein (aa 18-169, His Tag)Human IL36G / IL1F9 ProteinHuman IL36G / IL1F9 Protein (aa 18-169)Human IL1F5 / IL36RN ProteinHuman IL1R1 / CD121a Protein (Fc Tag)Human IL1R1 / CD121a Protein (His Tag)Human IL1R1 / CD121a ProteinHuman IL-1 alpha / IL1A / IL1F1 ProteinHuman IL-1 beta / IL1B Protein (pro form, His Tag)Human IL-1 beta / IL1B ProteinHuman IL37 / IL1F7 / IL-1H4 ProteinHuman IL-1R9 / IL1RAPL2 Protein (Fc Tag)Human IL-1R9 / IL1RAPL2 Protein (His Tag)Human IL18RAP / IL1R7 Protein (Fc Tag)Human IL18RAP / IL1R7 Protein (His Tag)Human IL-1R8 / IL1RAPL1 Protein (Fc Tag)Human IL-1R8 / IL1RAPL1 Protein (His Tag)Human IL18BPa Protein (His & Fc Tag)Human IL18BPa Protein (His Tag)Human IL33 / Interleukin-33 / NF-HEV ProteinHuman MKK6 / MEK6 / MAP2K6 Protein (His & GST Tag)Human MKK6 / MEK6 / MAP2K6 Protein (207 Ser/Asp, 211 Thr/Asp, His & GST Tag)Human MKK6 / MEK6 / MAP2K6 ProteinHuman MKK6 / MEK6 / MAP2K6 Protein (207 Asp, 211 Asp)Human IL36B / IL1F8 Protein (His Tag)Human IL36B / IL1F8 ProteinHuman IL1F6 / IL36A Protein (His Tag)Human IL1F6 / IL36A ProteinHuman IL1F6 / IL36 Protein (aa 6-158)Mouse IL18RAP / IL1R7 Protein (His Tag)Sus scrofa (Pig) IL1B / IL-1 beta ProteinHuman JNK2 / MAPK9 Protein (His Tag)Human p38 delta / MAPK13 Protein (GST Tag)Human JNK1 / MAPK8 Protein (GST Tag)Human IL18R1 / CD218a Protein (His & Fc Tag)Human IL18R1 / CD218a Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Human RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Human SIGIRR / TIR8 Protein (Fc Tag) Human SIGIRR / TIR8 Protein (His Tag)Human MARK3 / CTAK1 / EMK-2 Protein (His & GST Tag)Feline IL1B / IL-1 beta ProteinHuman IL1RL1 / ST2 Protein (isoform a, His Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Mouse IL18 / IL-18 ProteinMouse IL-18R1 Protein (His & Fc Tag)Mouse IL18R1 / CD218a Protein (His Tag)Mouse IL-1F6 / IL-1 epsilon ProteinMouse IL-1 beta / IL1B ProteinMouse IL-1 alpha / IL1A / IL1F1 ProteinMouse SIGIRR / TIR8 Protein (His & Fc Tag)Mouse IL18BP Protein (His Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Mouse ERK2 / MAPK1 / MAPK2 ProteinMouse MKK4 / MEK4 / MAP2K4 Protein (His & GST Tag)Mouse IL1RL1 / ST2 Protein (Fc Tag)Mouse IL1R1 / CD121a Protein (Fc Tag)Mouse IL1R1 / CD121a Protein (His Tag)Mouse IL-1R8 / IL1RAPL1 Protein (Fc Tag)Mouse IL1F8 / IL36b ProteinMouse IL1R2 / CD121b Protein (Fc Tag)Mouse IL1R2 / CD121b Protein (His Tag)Canine IL33 / Interleukin-33 / NF-HEV ProteinCanine IL-1 beta / IL1B ProteinRat IL-1 beta / IL1B Protein (pro form, His Tag)Rat IL-1 beta / IL1B Protein (mature form)Rat IL1R1 / CD121a Protein (His & Fc Tag)Rat IL1R1 / CD121a Protein (His Tag)Rat IL-1RA / IL1RN Protein (Fc Tag)Rat IL18R1 Protein (Fc Tag)Rat IL1R2 / IL1RB / CD121b Protein (His Tag)Mouse IL1RL1 / ST2 Protein (His Tag)Cynomolgus IL-1 beta / IL1B ProteinCynomolgus IL-18 / IL-1F4 Protein (His Tag)Cynomolgus IL1R2 / IL1RB Protein (Fc Tag)Cynomolgus IL18RAP Protein (Fc Tag)Cynomolgus IL18RAP Protein (His Tag)Cynomolgus IL1R1 Protein (Fc Tag)Cynomolgus IL1R1 Protein (His Tag)Human IL1F10 / IL-38 Protein (His Tag)Canine IL18R1 Protein (Fc Tag)
Background

X-linked interleukin-1 receptor accessory protein-like 2 (IL1RAPL2) or Interleukin-1 receptor 9 (IL-1R9) is a member of the interleukin 1 receptor family. This protein is similar to the interleukin 1 accessory proteins. IL-1R9/IL1RAPL2 shows restricted expression in fetal brain and is highly homologous to IL1RAPL, which is reportedly involved in nonsyndromic X-linked mental retardation. IL-1R9/IL1RAPL2 is highly homologous to IL-1R8. Both forms have no known ligands and receptor are found in the fetal brain. IL-1R9/IL1RAPL2 may function as a negative receptor. Both IL1RAPL1 and IL1RAPL2 have novel C-terminal sequences not present in other related proteins. IL-1R9/IL1RAPL2 may be strong candidates for X-linked non-syndromic mental retardation loci, and that molecules resembling IL-1 and IL-18 play a role in the development or function of the central nervous system.

References
  • Jin H, et al. (2000) Two novel members of the interleukin-1 receptor gene family, one deleted in Xp22.1-Xp21.3 mental retardation. Eur J Hum Genet. 8(2): 87-94.
  • Sana TR, et al. (2000) Computational identification, cloning, and characterization of IL-1R9, a novel interleukin-1 receptor-like gene encoded over an unusually large interval of human chromosome Xq22.2-q22.3. Genomics. 69(2): 252-62.
  • Gambino F, et al. (2007) IL1-receptor accessory protein-like 1 (IL1RAPL1), a protein involved in cognitive functions, regulates N-type Ca2+-channel and neurite elongation. Proc Natl Acad Sci. 104(21): 9063-8.
  • Size / Price
    Catalog:HG10156-UT
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 business days
    Images
    • Human IL1R9 / IL1RAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"