Quick Order

Human RPS6KB2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RPS6KB2 cDNA Clone Product Information
Gene_bank_ref_id:NM_003952.2
RefSeq ORF Size:1449bp
cDNA Description:Full length Clone DNA of Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 2 (RPS6KB2).
Gene Synonym:KLS, SRK, S6K2, STK14B, p70S6Kb, P70-beta, S6K-beta2, P70-beta-1, P70-beta-2, p70(S6K)-beta
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-RPS6KB2
Restriction Site:KpnI + NotI (6.1kb + 1.45kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG10152-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"