Quick Order

Human RPS6KA5 / MSK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RPS6KA5cDNA Clone Product Information
Gene_bank_ref_id:NM_004755.2
cDNA Size:2409
cDNA Description:ORF Clone of Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 5, transcript variant 1 DNA.
Gene Synonym:MSK1, RLPK, MSPK1, MGC1911
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human RPS6KA5 / MSK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human RPS6KA5 / MSK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10135-ACG$345
Human RPS6KA5 / MSK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10135-ACR$345
Human RPS6KA5 / MSK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10135-ANG$345
Human RPS6KA5 / MSK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10135-ANR$345
Human RPS6KA5 / MSK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10135-CF$315
Human RPS6KA5 / MSK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10135-CH$315
Human RPS6KA5 / MSK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10135-CM$315
Human RPS6KA5 / MSK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10135-CY$315
Human RPS6KA5 / MSK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10135-M$115
Human RPS6KA5 / MSK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10135-NF$315
Human RPS6KA5 / MSK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10135-NH$315
Human RPS6KA5 / MSK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10135-NM$315
Human RPS6KA5 / MSK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10135-NY$315
Human RPS6KA5 / MSK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10135-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:HG10135-UT
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability5 Business days
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"