Quick Order

Text Size:AAA

Human FABP2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FABP2cDNA Clone Product Information
cDNA Size:399
cDNA Description:ORF Clone of Homo sapiens fatty acid binding protein 2, intestinal (FABP2) DNA.
Gene Synonym:FABPI, I-FABP, MGC133132, FABP2
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Fatty acid binding protein (FABP) is one of the intracellular proteins, with a low molecular weight of approximately 15 kDa, that plays important roles in the transportation and metabolism of long-chain fatty acids. FABP family proteins could be used as tissue specific injury marker based on the following characteristics of FABP. The intestinal fatty acid binding protein (I-FABP), or fatty acid-binding protein 2 (FABP2), an intracellular protein expressed only in the intestine, involved in the absorption and intracellular transport of dietary long chain fatty acids. The FABP2 gene is proposed as a candidate gene for diabetes because the protein it codes is involved in fatty acid (FA) absorption and metabolism. Numerous studies have assessed FABP2 gene variants. A transition of G to A at codon 54 of FABP2 results in an amino acid substitution (Ala54 to Thr54), which is common in diverse populations and results in increased FA absorption in vivo. Some evidence indicates that this variant may be associated with type 2 diabetes. This polymorphism was associated with some cardiovascular risk factors. The cytosolic human intestinal fatty acid binding protein (hFABP2) is proposed to be involved in intestinal absorption of long-chain fatty acids. FABP2 may also help maintain energy homeostasis by functioning as a lipid sensor.

  • de Luis DA, et al. (2007) Influence of ALA54THR polymorphism of fatty acid-binding protein 2 on obesity and cardiovascular risk factors. Horm Metab Res. 39(11): 830-4.
  • Klapper M, et al.. (2007) The human intestinal fatty acid binding protein (hFABP2) gene is regulated by HNF-4alpha. Biochem Biophys Res Commun. 356(1): 147-52.