After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CD146 / MCAM natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MCAM cDNA Clone Product Information
Gene_bank_ref_id:NM_006500.2
RefSeq ORF Size:1941bp
cDNA Description:Full length Clone DNA of Homo sapiens melanoma cell adhesion molecule.
Gene Synonym:MCAM, CD146, MUC18
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-MCAM
Restriction Site:HindIII + XbaI (6.1kb + 1.94kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations 195C/T and 1800 A/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MCAM Gene Plasmid Map
Human CD146 / MCAM Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

The CD146 antigen, also known as melanoma cell adhesion molecule (MCAM) and MUC18, is an integral membrane glycoprotein belonging to the immunoglobulin superfamily. CD146 contains the characteristic immunoglobulin-like domains (V-V-C2-C2-C2), a transmembrane region and a short cytoplasmic tail. The CD146 expression is detected in endothelial cells in vascular tissue throughout the body, and plays a role in cell adhesion, as well as in cohesion of the endothelial monolayer at intercellular junctions in vascular tissue. As a Ca2+-independent cell adhesion molecule involved in heterophilic cell to cell interactions and a surface receptor, CD146 triggers tyrosine phosphorylation of FYN and PTK2 and subsequently induced signal transduction, proteolysis, or immune recognition. This protein is also expressed predominantly on metastatic lesions and advanced primary tumours, and thus has been suggested to play an important role in tumour progression and the development of metastasis in certain human carcinomas.

References
  • Mills L, et al. (2002) Fully human antibodies to MCAM/MUC18 inhibit tumor growth and metastasis of human melanoma. Cancer Res. 62(17): 5106-14.
  • Taira E, et al. (2004) Characterization of Gicerin/MUC18/CD146 in the rat nervous system. J Cell Physiol. 198(3): 377-87.
  • Fritzsche FR, et al. (2008) CD146 protein in prostate cancer: revisited with two different antibodies. Pathology. 40(5): 457-64.
  • Bidlingmaier S, et al. (2009) Identification of MCAM/CD146 as the target antigen of a human monoclonal antibody that recognizes both epithelioid and sarcomatoid types of mesothelioma. Cancer Res. 69(4): 1570-7.
  • Boneberg EM, et al. (2009) Soluble CD146 is generated by ectodomain shedding of membrane CD146 in a calcium-induced, matrix metalloprotease-dependent process. Microvasc Res. 78(3): 325-31.
  • Size / Price
    Catalog: HG10115-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"