Quick Order

Human CD106 / VCAM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
VCAM1cDNA Clone Product Information
Gene_bank_ref_id:NM_001078.2
cDNA Size:2220
cDNA Description:ORF Clone of Homo sapiens vascular cell adhesion molecule 1, transcript variant 1 DNA.
Gene Synonym:VCAM1, CD106, MGC99561, INCAM-100, DKFZp779G2333
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human CD106 / VCAM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human CD106 / VCAM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10113-ACG$345
Human CD106 / VCAM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10113-ACR$345
Human CD106 / VCAM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10113-CF$315
Human CD106 / VCAM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10113-CH$315
Human CD106 / VCAM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10113-CM$315
Human CD106 / VCAM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10113-CY$315
Human CD106 / VCAM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10113-M$115
Human CD106 / VCAM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10113-M-F$345
Human CD106 / VCAM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10113-M-N$345
Human CD106 / VCAM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10113-NF$315
Human CD106 / VCAM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10113-NH$315
Human CD106 / VCAM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10113-NM$315
Human CD106 / VCAM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10113-NY$315
Human CD106 / VCAM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10113-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Vascular cell adhesion molecule 1 (VCAM-1), also known as CD106, is a cell surface sialoglycoprotein belonging to the immunoglobulin superfamily. Two forms of VCAM-1 with either six or seven extracellular Ig-like domains are generated by alternative splicing, with the longer form predominant. VCAM-1 is an endothelial ligand for very late antigen-4 (VLA-4) and α4ß7 integrin expressed on leukocytes, and thus mediates leukocyte-endothelial cell adhesion and signal transduction. VCAM-1 expression is induced on endothelial cells during inflammatory bowel disease, atherosclerosis, allograft rejection, infection, and asthmatic responses. During these responses, VCAM-1 forms a scaffold for leukocyte migration. VCAM-1 also activates signals within endothelial cells resulting in the opening of an "endothelial cell gate" through which leukocytes migrate. VCAM-1 has been identified as a potential anti-inflammatory therapeutic target, the hypothesis being that reduced expression of VCAM-1 will slow the development of atherosclerosis. In addition, VCAM-1-activated signals in endothelial cells are regulated by cytokines indicating that it is important to consider both endothelial cell adhesion molecule expression and function during inflammatory processes.

References
  • Cook-Mills JM. (2002) VCAM-1 signals during lymphocyte migration: role of reactive oxygen species. Mol Immunol. 39(9): 499-508.
  • Preiss DJ, et al. (2007) Vascular cell adhesion molecule-1: a viable therapeutic target for atherosclerosis? Int J Clin Pract. 61(4): 697-701.
  • Size / Price
    Catalog:HG10113-UT
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"