After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human EIF2AK2 / PKR natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human EIF2AK2 cDNA Clone Product Information
Gene_bank_ref_id:NM_002759.1
RefSeq ORF Size:1656bp
cDNA Description:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2-alpha, kinase 2.
Gene Synonym:EIF2AK2, PKR, PRKR, EIF2AK1, MGC126524
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-EIF2AK2
Restriction Site:KpnI + XbaI (6.1kb + 1.66kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human EIF2AK2 Gene Plasmid Map
Human EIF2AK2 / PKR natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG10080-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"