Quick Order

Text Size:AAA

Human Cadherin-11 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CDH11 cDNA Clone Product Information
NCBI RefSeq:NM_001797.2
RefSeq ORF Size:2391bp
cDNA Description:Full length Clone DNA of Homo sapiens cadherin 11, type 2, OB-cadherin (osteoblast).
Gene Synonym:CDH11, OB, CAD11, CDHOB, OSF-4
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CDH11
Restriction Site:KpnI + XbaI (6.1kb + 2.39kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 825 G/A and 1117 T/G resulting in the amino acid MET substitution by ILE and ser substitution by ala.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CDH11 Gene Plasmid Map
Human Cadherin-11 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG10065-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"