Quick Order

Human BCL2L2 / BCL2-like 2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BCL2L2 cDNA Clone Product Information
Gene_bank_ref_id:NM_004050.3
RefSeq ORF Size:582bp
cDNA Description:Full length Clone DNA of Homo sapiens BCL2-like 2.
Gene Synonym:BCL2L2, BCLW, BCL-W, KIAA0271
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-BCL2L2
Restriction Site:KpnI + XbaI (6.1kb + 0.58kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 123 G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Beta1,4-Galactosyltransferase-I (B4GALT1), one of seven beta1,4-galactosyltransferases, is an enzyme commonly found in the trans-Golgi complex that adds galactose to oligosaccharides. They have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. B4GALT1 gene directs production of B4GALT1 protein using either of two transcription start sites. The product of the smaller transcript serves the traditional biosynthetic role in the Golgi. This form also complexes with α-lactalbumin, a mammary-specific protein, to form lactose synthase. In addition to a biosynthetic role, the protein translated from the longer transcript appears on the plasma membranes of some cells where it serves as a signalling receptor in cell-matrix interactions such as sperm-egg binding.

References
  • Hennet T. (2002) The galactosyltransferase family. Cellular and Molecular Life Sciences. 59(7): 1081-95.
  • Landers EA, et al. (2009) Porcine 1, 4-Galactosyltransferase-I Sequence and Expression. Reproduction in Domestic Animals. 44(2): 228-34.
  • Amado M, et al. (2000) Identification and characterization of large galactosyltransferase gene families: galactosyltransferases for all functions. Biochim Biophys Acta. 1473 (1): 35-53.
  • Size / Price
    Catalog: HG10059-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"