Quick Order

Text Size:AAA

Human MAPT / Tau transcript variant 4 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MAPT cDNA Clone Product Information
Gene_bank_ref_id:NM_016841.2
RefSeq ORF Size:1059bp
cDNA Description:Full length Clone DNA of Homo sapiens microtubule-associated protein tau (MAPT), transcript variant 4.
Gene Synonym:MAPT, TAU, MSTD, PPND, DDPAC, MAPTL, MTBT1, MTBT2, FTDP-17
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-MAPT
Restriction Site:KpnI + XbaI (6.1kb + 1.06kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

MAPT (microtubule-associated protein tau) can produce tau proteins. Tau proteins are proteins that stabilize microtubules. They are abundant in neurons of the central nervous system and are less common elsewhere, but are also expressed at very low levels in CNS astrocytes and oligodendrocytes. When tau proteins are defective, and no longer stabilize microtubules properly, they can result in dementias such as Alzheimer's disease. Tau protein is a highly soluble microtubule-associated protein (MAP). In humans, these proteins are mostly found in neurons compared to non-neuronal cells. One of tau's main functions is to modulate the stability of axonal microtubules. Other nervous system MAPs may perform similar functions, as suggested by tau knockout mice, who did not show abnormalities in brain development - possibly because of compensation in tau deficiency by other MAPs.

References
  • Harada A, et al. (1994) Altered microtubule organization in small-calibre axons of mice lacking tau protein. Nature. 369(6480):488-91.
  • Weingarten MD, et al. (1975) A protein factor essential for microtubule assembly. Proc Natl Acad Sci. 72(5):1858-62.
  • Goedert M, et al. (1989) Multiple isoforms of human microtubule-associated protein tau: sequences and localization in neurofibrillary tangles of Alzheimer's disease. Neuron. 3(4): 519-26.
  • Size / Price
    Catalog: HG10058-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"