Quick Order

Text Size:AAA

Human Caspase-7 transcript variant alpha natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CASP7 cDNA Clone Product Information
Gene_bank_ref_id:NM_001227.3
RefSeq ORF Size:912bp
cDNA Description:Full length Clone DNA of Homo sapiens caspase 7, apoptosis-related cysteine peptidase (CASP7), transcript variant alpha.
Gene Synonym:CASP7, MCH3, CMH-1, ICE-LAP3
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CASP7
Restriction Site:KpnI + XbaI (6.1kb + 0.91kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human Caspase-7 transcript variant alpha natural ORF mammalian expression plasmid on other vectors
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-GFPSpark tagHG10049-ACG$325
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10049-ACR$325
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-GFPSpark tagHG10049-ANG$325
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10049-ANR$325
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-Flag tagHG10049-CF$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-His tagHG10049-CH$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-Myc tagHG10049-CM$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-HA tagHG10049-CY$295
Human Caspase-7 transcript variant alpha Gene cDNA clone plasmidHG10049-M$95
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, Flag tagHG10049-M-F$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-Flag tagHG10049-NF$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-His tagHG10049-NH$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-Myc tagHG10049-NM$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-HA tagHG10049-NY$295
Human Caspase-7 transcript variant alpha natural ORF mammalian expression plasmidHG10049-UT$295
 Learn more about expression Vectors
Product nameProduct name
Background

Caspase 7, also known as caspase-7 and MCH3, belongs to the cysteine-aspartic acid protease (caspase) family. Caspases play a role in the signal transduction pathways of apoptosis, necrosis and inflammation. There are two major classes of caspases: initiators and effectors. The initiator isoforms (caspases-1,-4,-5,-8,-9,-10,-11,-12) are activated by, and interact with, upstream adaptor molecules through protein-protein interaction domains known as CARD and DED. Effector caspases (-3,-6,-7) are responsible for cleaving downstream substrates and are sometimes referred to as the executioner caspases. Caspase 7 exists in lung, skeletal muscle, liver, kidney, spleen and heart, and moderately in testis. Caspase 7 cannot be detected in the brain. Caspase 7 functions in the activation cascade of caspases responsible for apoptosis execution. It cleaves and activates sterol regulatory element binding proteins (SREBPs). It proteolytically cleaves poly(ADP-ribose) polymerase (PARP) at a '216-Asp- -Gly-217' bond. Overexpression promotes programmed cell death.

References
  • Riedl S J, et al. (2001) Structural basis for the inhibition of caspase-3 by XIAP. Cell. 104(5):791-800.
  • Roy N, et al. (1997) The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases. EMBO J. 16(23):6914-25.
  • Deveraux Q L, et al. (1997) X-linked IAP is a direct inhibitor of cell-death proteases. Nature. 388(6639): 300-4.
  • Size / Price
    Catalog: HG10049-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"