After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SPARCL1cDNA Clone Product Information
cDNA Size:1995
cDNA Description:ORF Clone of Homo sapiens SPARC-like 1 (hevin), transcript variant 2 DNA.
Gene Synonym:SC1, PIG33, SPARCL1
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10046-ACG$345
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10046-ACR$345
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10046-CF$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10046-CH$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10046-CM$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10046-CY$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone)HG10046-M$115
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10046-M-F$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10046-NF$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10046-NH$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10046-NM$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10046-NY$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10046-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

SPARC-like protein 1 (SPARCL1; also known as SC1, high endothelial venule protein, or hevin) is an extracellular matrix-associated, secreted glycoprotein belonging to the secreted protein acidic and rich in cysteine (SPARC) family of matricellular proteins. It contains three conserved structural domains that are implicated in the regulation of cell adhesion, migration, and proliferation. SPARCL1 is expressed during embryogenesis and tissue remodeling and is especially prominent in brain and vasculature. Its down-regulation in a number of cancers and the possibility of its functional compensation by SPARC has led to recent interest in hevin as a tumor suppressor and regulator of angiogenesis. SPARCL1 has antiadhesive properties, and loss of SPARCL1 expression is associated with increased proliferative activity and cell cycle progression. It is suggested that it may influence multiple cellular processes during distinct stages of brain development and function. In addition, SPARCL1 can influence the function of astroglial cells in the developing and mature central nervous system (CNS).

  • Sullivan MM, et al. (2004) Hevin/SC1, a matricellular glycoprotein and potential tumor-suppressor of the SPARC/BM-40/Osteonectin family. Int J Biochem Cell Biol. 36(6): 991-6.
  • Esposito I, et al. (2007) Tumor-suppressor function of SPARC-like protein 1/Hevin in pancreatic cancer. Neoplasia. 9(1): 8-17.
  • Weimer JM, et al. (2008) A BAC transgenic mouse model to analyze the function of astroglial SPARCL1 (SC1) in the central nervous system. Glia. 56(9): 935-41.