Quick Order

Text Size:AAA

Human CD137 / 4-1BB / TNFRSF9 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TNFRSF9 cDNA Clone Product Information
Gene_bank_ref_id:NM_001561.4
RefSeq ORF Size:768bp
cDNA Description:Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 8.
Gene Synonym:TNFRSF9, ILA, 4-1BB, CD137, CDw137, MGC2172
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-TNFRSF9
Restriction Site:KpnI + XbaI (6.1kb + 0.77kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Human 4-1BBL / CD137L Protein (Fc Tag, ECD)Human GITR / TNFRSF18 Protein (His Tag, ECD)Canine CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Human TL1A / TNFSF15 Protein (Fc Tag)Cynomolgus LTB / TNFSF3 / Lymphotoxin beta Protein (His Tag)Cynomolgus TNFRSF21 / DR6 Protein (His Tag)Cynomolgus TNF-alpha / TNFA ProteinHuman XEDAR / EDA2R Protein (Fc Tag)Cynomolgus XEDAR / EDA2R Protein (ECD, His Tag)Human CD40 / TNFRSF5 Protein (ECD, Fc Tag)Rabbit NGFR / TNFRSF16 / P75 Protein (ECD, His Tag)Cynomolgus RANKL / OPGL / TNFSF11 Protein (Fc Tag)Rhesus OX40 / CD134 Protein (Fc Tag)Rhesus CD137 / 4-1BB Protein (Fc Tag)Mouse TNFSF12 Protein (Fc Tag)Human TNFRSF17 / BCMA / CD269 Protein (Fc Tag)Rhesus CD137 / 4-1BB Protein (His Tag)Canine BLyS / TNFSF13B / BAFF Protein (Fc Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 ProteinHuman CD137 / 4-1BB / TNFRSF9 Protein (His & Fc Tag)Human CD27 / TNFRSF7 Protein (His & Fc Tag)Human CD153 / CD30L / TNFSF8 Protein (Fc Tag)Human CD40 / TNFRSF5 Protein (His & Fc Tag)Human DR6 / TNFRSF21 Protein (Fc Tag)Human DR6 / TNFRSF21 ProteinHuman FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Human HVEM / TNFRSF14 Protein (His & Fc Tag)Human TNFSF14 / LIGHT / CD258 Protein (His Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His & Fc Tag)Human TNFRSF4 / OX40 / CD134 Protein (His & Fc Tag)Human TNF-alpha / TNFA ProteinHuman TRAIL R1 / CD261 / TNFRSF10A Protein (His & Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His & Fc Tag)Mouse 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (Fc Tag)Human CD30 / TNFRSF8 Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His & Fc Tag)Human RELT / TNFRSF19L Protein (His & Fc Tag)Human CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human CD40 / TNFRSF5 Protein (His Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (His & Fc Tag)Mouse TNFRSF19 / TROY Protein (His & Fc Tag)Human BLyS / TNFSF13B / BAFF Protein (Fc Tag)Mouse TNF-alpha / TNFA ProteinHuman DR6 / TNFRSF21 Protein (His Tag)Human TNFRSF17 / BCMA / CD269 Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Mouse TNFRSF19 / TROY Protein (His Tag)Mouse DR6 / TNFRSF21 Protein (His Tag)Human TNFRSF4 / OX40 / CD134 Protein (His Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Mouse FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Human RELT / TNFRSF19L Protein (His Tag)Mouse CD27 / TNFRSF7 Protein (His Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Canine TNF-alpha / TNFA / TNFSF1A ProteinHuman EDAR / DL Protein (Fc Tag)Human EDAR / DL Protein (His Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His Tag)Human Osteoprotegerin / TNFRSF11B Protein (His Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Human HVEM / TNFRSF14 Protein (His Tag)Human TNFRSF25 / DR3 / TNFRSF12 Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (His Tag)Human CD30 / TNFRSF8 Protein (His Tag)Human BLyS / TNFSF13B / BAFF ProteinHuman XEDAR / EDA2R Protein (His Tag)Human CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Cynomolgus / Rhesus TNF-alpha / TNFA / TNFSF1A / Cachectin ProteinHuman TNFRSF13B / TACI / CD267 Protein (His Tag)Human TNF-beta / TNFSF1 / Lymphotoxin alpha ProteinMouse PGLYRP1 / PGRP-S Protein (His Tag)Mouse BAFFR / TNFRSF13C / CD268 Protein (Fc Tag)Rat TNF-alpha / TNFA ProteinFerret TNF-alpha / TNFA ProteinHuman TNFSF10 / TRAIL / APO-2L / CD253 ProteinMouse CD40 / TNFRSF5 Protein (His & Fc Tag)Mouse CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Mouse TNFRSF4 / OX40 / CD134 Protein (Fc Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Mouse NGFR / P75 Protein (His Tag)Human OX-40L / TNFSF4 / CD252 Protein (Fc Tag)Mouse NGFR / P75 Protein (Fc Tag)Human NGFR / P75 Protein (Fc Tag)Human NGFR/ P75 Protein (His Tag)Mouse RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human TNFRSF12A / FN14 / TWEAKR Protein (Fc Tag)Rat LTBR / TNFRSF3 Protein (His Tag)Human BLyS / TNFSF13B / BAFF ProteinMouse TNFSF10 / TRAIL / APO-2L Protein (aa 118-291, His Tag)Mouse CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rat EDAR Protein (Fc Tag)Rat TNFRSF11A Protein (His Tag)Rat TNFRSF17 / BCMA Protein (Fc Tag)Rat XEDAR / EDA2R Protein (Fc Tag)Rhesus TNFSF10 / TRAIL / APO-2L ProteinRat 4-1BBL / CD137L / TNFSF9 Protein (Fc Tag)Rat 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Rat TNFRSF11A Protein (Fc Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Rat XEDAR / EDA2R Protein (His Tag)Rat TNFSF15 / TL1A Protein (Fc Tag)Human CD27 / TNFRSF7 Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Mouse TNFSF13 Protein (Fc Tag)Mouse XEDAR / EDA2R Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (His Tag)Human TNFRSF19 / TROY Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (His Tag)Rhesus CD40 / TNFRSF5 Protein (Fc Tag)Rhesus CD40 / TNFRSF5 Protein (His Tag)Rhesus TNFRSF17 / BCMA Protein (Fc Tag)Rat GITR / TNFRSF18 Protein (Fc Tag)Rat CD153 / CD30L / TNFSF8 Protein (Fc Tag)Cynomolgus LTBR / TNFRSF3 Protein (Fc Tag)Cynomolgus EDAR Protein (Fc Tag)Rat CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rat TNFSF12 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (Fc Tag)Rhesus TRAIL R4 / CD264 / TNFRSF10D Protein (Fc Tag)Rhesus TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Rhesus Osteoprotegerin / TNFRSF11B Protein (Fc Tag)Human CD153 / CD30L / TNFSF8 ProteinHuman RANKL / OPGL / TNFSF11 / CD254 ProteinRhesus CD27 / TNFRSF7 Protein (Fc Tag)Cynomolgus / Human TNFSF12 Protein (Fc Tag)Human CD27 / TNFRSF7 Protein (His Tag)Human GITR / TNFRSF18 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (His Tag)Cynomolgus HVEM / TNFRSF14 Protein (Fc Tag)Human DCR3 / TNFRSF6B Protein (Fc Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Rhesus CD40L / CD154 / TNFSF5 Protein (Fc Tag)Human TNFRSF19 / TROY Protein (His Tag)Rat CD153 / CD30L / TNFSF8 ProteinRat LTBR / TNFRSF3 Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Cynomolgus EDAR Protein (His Tag)Cynomolgus BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Rat BAFFR / TNFRSF13C Protein (His Tag)Cynomolgus XEDAR / EDA2R Protein (Fc Tag)Canine CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Cynomolgus OX-40L / TNFSF4 Protein (Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (aa 1-268, 196 Met/Arg, His Tag)Canine CD40 / TNFRSF5 Protein (Fc Tag)Rat BAFFR / TNFRSF13C Protein (Fc Tag)Canine CD40 / TNFRSF5 ProteinHuman Fas Ligand / FASLG / CD95L Protein (His Tag)Canine CD40L / CD154 / TNFSF5 Protein (Fc Tag)Canine CD40L / CD154 / TNFSF5 ProteinCanine CD40 / TNFRSF5 Protein (His Tag)Human TNFRSF11A Protein (Fc Tag)Mouse CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human TNF-alpha / TNFA Protein (Fc Tag)Human TNFRSF11A Protein (His Tag)Mouse Osteoprotegerin / TNFRSF11B Protein (Fc Tag)
Background

CD137 (also known as 4-1BB) is a surface co-stimulatory glycoprotein originally described as present on activated T lymphocytes, which belongs to the tumor necrosis factor (TNF) receptor superfamily. It is expressed mainly on activated CD4+ and CD8+ T cells, and binds to a high-affinity ligand (4-1BBL) expressed on several antigen-presenting cells such as macrophages and activated B cells. Upon ligand binding, 4-1BB is associated with the tumor necrosis factor receptor–associated factors (TRAFs), the adaptor protein which mediates downstream signaling events including the activation of NF-kappaB and cytokine production. 4-1BB signaling either by binding to 4-1BBL or by antibody ligation delivers signals for T-cell activation and growth, as well as monocyte proliferation and B-cell survival, and plays an important role in the amplification of T cell-mediated immune responses. In addition, CD137 and CD137L are expressed in different human primary tumor tissues, suggesting that they may influence the progression of tumors. Crosslinking of CD137 on activated T cells has shown promise in enhancing anti-tumor immune responses in murine models, and agonistic anti-CD137 antibodies are currently being tested in phase I clinical trials.

References
  • Sica G, et al. (1999) Biochemical and immunological characteristics of 4-1BB (CD137) receptor and ligand and potential applications in cancer therapy. Arch Immunol Ther Exp (Warsz). 47(5): 275-9.
  • Nam KO, et al. (2005) The therapeutic potential of 4-1BB (CD137) in cancer. Curr Cancer Drug Targets. 5(5): 357-63.
  • Wang Q, et al. (2008) Analysis of CD137 and CD137L expression in human primary tumor tissues. Croat Med J. 49(2): 192-200.
  • Melero I, et al. (2008) Multi-layered action mechanisms of CD137 (4-1BB)-targeted immunotherapies. Trends Pharmacol Sci. 29(8): 383-90.
  • Thum E, et al. (2009) CD137, implications in immunity and potential for therapy. Front Biosci. 14: 4173-88.
  • Size / Price
    Catalog: HG10041-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"