Quick Order

Text Size:AAA

Human MKNK1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
MKNK1cDNA Clone Product Information
Gene Bank Ref.ID:NM_198973.2
cDNA Size:1044
cDNA Description:ORF Clone of Homo sapiens MAP kinase interacting serine/threonine kinase 1, transcript variant 2 DNA.
Gene Synonym:MKNK1, RP11-49P4.3
Species:Human
Vector:pCMV3-untagged
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 148 C/T not causing the amino acid variation.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human MKNK1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human MKNK1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10038-ACG$325
Human MKNK1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10038-ANG$325
Human MKNK1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10038-CF$295
Human MKNK1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10038-CH$295
Human MKNK1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10038-CM$295
Human MKNK1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10038-CY$295
Human MKNK1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone)HG10038-M$195
Human MKNK1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10038-M-F$395
Human MKNK1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10038-NF$295
Human MKNK1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10038-NH$295
Human MKNK1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10038-NM$295
Human MKNK1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10038-NY$295
Human MKNK1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10038-UT$295
 
Related Products
Product nameProduct name
Size / Price
Catalog:HG10038-UT
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availsability:5 Business days
Images
    Please note:All products are "FOR RESEARCH UES ONLY AND ARE NOT INTENDED FOR DIAGNOSTICE OFR THERAPEUTIC USE"