Quick Order

Human HIST3H2BB natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human HIST3H2BB cDNA Clone Product Information
NCBI RefSeq:NM_175055.2
RefSeq ORF Size:381bp
cDNA Description:Full length Clone DNA of Homo sapiens histone cluster 3, H2bb.
Gene Synonym:HIST2H2BE, H2B, GL105, H2B.1, H2B/q, H2BFQ
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-HIST3H2BB
Restriction Site:KpnI + XbaI (6.1kb + 0.38kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG10031-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"