Quick Order

Text Size:AAA

Human MAPK7 / ERK5 / BMK1 transcript variant 3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MAPK7 cDNA Clone Product Information
Gene_bank_ref_id:NM_002749.2
RefSeq ORF Size:2451bp
cDNA Description:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 7 (MAPK7), transcript variant 3.
Gene Synonym:MAPK7, BMK1, ERK4, ERK5, PRKM7
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-MAPK7
Restriction Site:HindIII + XbaI (6.1kb + 2.45kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MAPK7 / ERK5 / BMK1 transcript variant 3 natural ORF mammalian expression plasmid on other vectors
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-GFPSpark tagHG10024-ACG$345
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10024-ACR$345
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-GFPSpark tagHG10024-ANG$345
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10024-ANR$345
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-Flag tagHG10024-CF$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-His tagHG10024-CH$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-Myc tagHG10024-CM$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-HA tagHG10024-CY$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 Gene cDNA clone plasmidHG10024-M$295
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, Flag tagHG10024-M-F$545
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-Flag tagHG10024-NF$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-His tagHG10024-NH$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-Myc tagHG10024-NM$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-HA tagHG10024-NY$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 natural ORF mammalian expression plasmidHG10024-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: HG10024-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"