Quick Order

Text Size:AAA

Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BADcDNA Clone Product Information
cDNA Size:507
cDNA Description:ORF Clone of Homo sapiens BCL2-antagonist of cell death (BAD), transcript variant 1 DNA.
Gene Synonym:BAD, BBC2, BCL2L8
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10020-ACG$325
Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10020-ACR$325
Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10020-ANG$325
Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10020-ANR$325
Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10020-CF$295
Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10020-CH$295
Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10020-CM$295
Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10020-CY$295
Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10020-M$95
Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10020-M-F$295
Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10020-NF$295
Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10020-NH$295
Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10020-NM$295
Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10020-NY$295
Human BAD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10020-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 Business days
    Recently Viewed Items