Quick Order

Human RPS6KA3 / RSK2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RPS6KA3 cDNA Clone Product Information
Gene_bank_ref_id:NM_004586.2
RefSeq ORF Size:2223bp
cDNA Description:Full length Clone DNA of Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 3.
Gene Synonym:RPS6KA3, CLS, RSK, HU-3, RSK2, MRX19, ISPK-1, p90-RSK2, pp90RSK2, MAPKAPK1B
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-RPS6KA3
Restriction Site:KpnI + XbaI (6.1kb + 2.22kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 798 C/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG10018-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"