Quick Order

Human bFGF Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FGF2cDNA Clone Product Information
cDNA Size:468
cDNA Description:ORF Clone of Homo sapiens fibroblast growth factor 2 (basic) DNA.
Gene Synonym:FGF2, BFGF, FGFB, HBGF-2
Restriction Site:
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in E. coli system. The translated amino acid sequence is identical with AAA52533.1.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human bFGF Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged on other vectors
Human bFGF Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10014-ACG$325
Human bFGF Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-OFPSpark tagHG10014-ACR$325
Human bFGF Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10014-ANG$325
Human bFGF Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-OFPSpark-taggedHG10014-ANR$325
Human bFGF Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedHG10014-CF$295
Human bFGF Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedHG10014-CH$295
Human bFGF Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedHG10014-CM$295
Human bFGF Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedHG10014-CY$295
Human bFGF Gene cDNA Clone (Codon Optimized, full-length ORF Clone)HG10014-M$95
Human bFGF Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedHG10014-NF$295
Human bFGF Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedHG10014-NH$295
Human bFGF Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedHG10014-NM$295
Human bFGF Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedHG10014-NY$295
Human bFGF Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedHG10014-UT$295
 Learn more about expression Vectors
Fibroblast Growth Factor (FGF) & Receptor Related Products
Product nameProduct name
Cynomolgus FGFR1 / CD331 Protein (His Tag)Canine FGF14 / SCA27 ProteinCanine FGF9 / FGF-9 Protein (Fc Tag)Cynomolgus FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Human / Cynomolgus FGF16 / FGF-16 ProteinHuman FGFR2 / CD332 Protein (ECD, His Tag)Mouse bFGF / FGF2 Protein (His Tag)Cynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), His Tag)Human FGFR2 / CD332 Protein (beta(IIIc), His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), Fc Tag)Human FGF7 / FGF-7 / KGF Protein (His Tag)Human FGFR2 / CD332 Protein (alpha(IIIb), Fc Tag)Human aFGF / FGF1 ProteinHuman bFGF / FGF2 ProteinHuman FGF9 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Human FGF10 ProteinHuman FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR1 / CD331 Protein (His Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human FGFR2 Protein (His & Fc Tag)Human FGFR2 / CD332 Protein (His Tag)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Human FGF21 Protein (His Tag)Human FGFBP3 Protein (His Tag)Human FGF19 ProteinHuman FGF17 ProteinHuman FGF18 / FGF-18 Protein (His Tag)Human FGF14 / SCA27 Protein (isoform 1B)Cynomolgus FGFR3 Protein (Fc Tag)Human FGFR1OP / FOP Protein (His & GST Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His Tag)Mouse FGF18 / FGF-18 Protein (His Tag)Mouse / Rat aFGF / FGF1 ProteinMouse FGFRL1 / FGFR5 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Mouse FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (His Tag)Canine aFGF / FGF1 ProteinCanine FGF12 ProteinRat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Cynomolgus aFGF / FGF1 ProteinCynomolgus FGFR1 / CD331 Protein (Fc Tag)Cynomolgus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Cynomolgus FGFR4 / FGF Receptor 4 Protein (His Tag)Human FGFR3 / CD333 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (Fc Tag, ECD)Mouse FGF7 / FGF-7 / KGF Protein (His Tag)

Basic fibroblast growth factor (bFGF), also known as FGF2, is a member of the fibroblast growth factor (FGF) family. It is a highly specific chemotactic and mitogenic factor for many cell types, appears to be involved in remodeling damaged tissue, such as ulcer healing, vascular repair, traumatic brain injury (TBI). bFGF is a critical component of human embryonic stem cell culture medium. In addition, bFGF protein is a heparin-binding cationic protein involved in a variety of pathological conditions including angiogenesis and solid tumour growth. Thus, bFGF is regarded as a target for cancers chemopreventive and therapeutic strategies.

bFGF/FGF2 Protein & Antibody Products

  • Takayama S,et al. (2001) Periodontal regeneration by FGF-2 (bFGF) in primate models. J Dent Res. 80(12): 2075-9.
  • Niu YJ, et al. (2004) Therapeutic effect of bFGF on retina ischemia-reperfusion injury. Chin Med J (Engl). 117(2): 252-7.
  • Zhang Y,et al. (2004) Expression of aFGF, bFGF, and FGFR1 in ovarian epithelial neoplasm. Chin Med J (Engl). 117(4): 601-3.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 Business days
      Recently Viewed Items