Quick Order

Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSF3cDNA Clone Product Information
Gene_bank_ref_id:NM_000759.2
cDNA Size:624
cDNA Description:ORF Clone of Homo sapiens colony stimulating factor 3 (granulocyte), transcript variant 1 DNA.
Gene Synonym:CSF3, GCSF, G-CSF
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10006-ACG$325
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10006-ACR$325
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10006-CF$295
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10006-CH$295
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10006-CM$295
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10006-CY$295
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10006-M$95
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10006-M-F$295
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10006-M-N$295
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10006-NF$295
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10006-NH$295
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10006-NM$295
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10006-NY$295
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10006-UT$295
 Learn more about expression Vectors
Colony-Stimulating Factor (CSF) & Receptor Related Products
Background

Granulocyte-colony stimulating factor (G-CSF) is a growth factor and an essential cytokine belonging to the CSF family of hormone-like glycoproteins. It is produced by numerous cell types including immune and endothelial cells. G-CSF binding to its receptor G-CSF-R which belongs to the cytokine receptor type I family depends on the interaction of alpha-helical motifs of the former and two fibronectin type III as well as an immunoglobulin-like domain of the latter. Recent animal studies have also revealed that G-CSF activates multiple signaling pathways, such as Akt and also the Janus family kinase-2 and signal transducer and activation of transcription-3 (Jak2-STAT3) pathway, thereby promoting survival, proliferation, differentiation and mobilisation of haematopoietic stem and progenitor cells. G-CSF is a cytokine that have been demonstrated to improve cardiac function and perfusion in myocardial infarction. And it was initially evaluated as a stem cell mobilizer and erythropoietin as a cytoprotective agent. G-CSF prevents left ventricular remodeling after myocardial infarction by decreasing cardiomyocyte death and by increasing the number of blood vessels, suggesting the importance of direct actions of G-CSF on the myocardium rather than through mobilization and differentiation of stem cells. Accordingly, recombinant human (rh)G-CSF has been extensively used in clinical haematology and oncology to enable bone marrow transplantation or to treat chemotherapy-associated neutropenia. In preclinical study, G-CSF improved cardiac function and perfusion by angiomyogenesis and protection of cardiomyocytes in myocardial infarction.

References
  • Takano H, et al. (2007) G-CSF therapy for acute myocardial infarction. Trends Pharmacol Sci. 28(10): 512-7.
  • Klocke R, et al. (2008) Granulocyte colony-stimulating factor (G-CSF) for cardio- and cerebrovascular regenerative applications. Curr Med Chem. 15(10): 968-77.
  • Kang HJ, et al. (2008) G-CSF- and erythropoietin-based cell therapy: a promising strategy for angiomyogenesis in myocardial infarction. Expert Rev Cardiovasc Ther. 6(5): 703-13.
  • Beekman R, et al. (2010) G-CSF and its receptor in myeloid malignancy. Blood. 115(25): 5131-6.
  • Size / Price
    Catalog:HG10006-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"