Quick Order

Human ErbB2 / HER2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
ERBB2cDNA Clone Product Information
Gene Bank Ref.ID:NM_004448.2
cDNA Size:3768
cDNA Description:ORF Clone of Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian), transcript variant 1 DNA.
Gene Synonym:ErbB2, NEU, NGL, HER2, TKR1, CD340, HER-2, c-erbB2, HER-2/neu, p185erbB2
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human ErbB2 / HER2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Epidermal Growth Factor (EGF) & Receptor Related Products
Product nameProduct name
Canine NRG1-alpha Protein (ECD, Fc Tag)Human TGFA / TGF-alpha ProteinHuman NRG1 Protein (His Tag, ECD)Canine NRG1-alpha Protein (ECD)Mouse EGFL6 / EGF-L6 Protein (His Tag)Mouse EGFL6 / EGF-L6 Protein (Fc Tag)Human TMEFF1 / Tomoregulin-1 Protein (Fc Tag, ECD)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, Fc Tag)Human HER2 / ErbB2 ProteinMouse EGF / Epidermal growth factor Protein (His Tag)Rhesus HER3 / ErbB3 ProteinHuman HER3 / ErbB3 ProteinRhesus EGFR / HER1 / ErbB1 Protein (ECD, His Tag)Cynomolgus / Rhesus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Human NRG1 Protein (Fc Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (His Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human HBEGF / DTR ProteinHuman / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human EGF / Epidermal Growth Factor Protein (Fc Tag)Human EGF / Epidermal Growth Factor ProteinHuman Epiregulin / EREG Protein (Fc Tag) Human EGFL6 / EGF-L6 Protein (His Tag)Cynomolgus HER2 / ErbB2 Protein (His Tag)Human NRG1-beta 1 Protein (EGF Domain, Fc Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG4 ProteinHuman BTC / Betacellulin Protein (Fc Tag)Human BTC / Betacellulin ProteinHuman NRG1-alpha Protein (EGF Domain, Fc Tag)Human NRG1-alpha Protein (ECD, Fc Tag)Human NRG1-alpha Protein (ECD, His Tag)Mouse BTC / Betacellulin Protein (His & Fc Tag)Mouse EGFL7 / VE-statin Protein (His Tag)Mouse EGF / Epidermal Growth Factor Protein (Fc Tag)Mouse EGF / Epidermal Growth Factor ProteinMouse EGF / Epidermal Growth Factor ProteinMouse LRIG1 / LIG-1 Protein (His Tag)Mouse Epiregulin / EREG Protein (Fc Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Canine HER2 / ErbB2 Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Mouse HER4 / ErbB4 Protein (His Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Canine EGF / Epidermal Growth Facto Protein (His Tag)Rat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rat HER2 / ErbB2 ProteinRat EGFR / HER1 / ErbB1 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Cynomolgus BTC / Betacellulin Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Rhesus EGFR / HER1 / ErbB1 Protein (His Tag, ECD)Mouse TMEFF1 / Tomoregulin-1 Protein (Fc Tag)Rat EGF / Epidermal Growth Factor ProteinCanine NRG1 Protein (His Tag)Rat HER4 / ErbB4 Protein (His Tag)Canine NRG1-alpha Protein (EGF Domain, Fc Tag)Canine NRG1-alpha Protein (ECD, His Tag)

Human epidermal growth factor receptor 2 (HER2), also known as ErbB2, NEU, and CD340, is a type I membrane glycoprotein, and belongs to the epidermal growth factor (EGF) receptor family. HER2 protein cannot bind growth factors due to the lacking of ligand binding domain of its own and autoinhibited constitutively. However, HER2 forms a heterodimer with other ligand-bound EGF receptor family members, therefore stabilizes ligand binding and enhances kinase-mediated activation of downstream molecules. HER2 plays a key role in development, cell proliferation and differentiation. HER2 gene has been reported to associate with malignancy and a poor prognosis in numerous carcinomas, including breast, prostate, ovarian, lung cancers and so on.

  • Krawczyk N, et al. (2009) HER2 status on persistent disseminated tumor cells after adjuvant therapy may differ from initial HER2 status on primary tumor. Anticancer Res. 29(10): 4019-24.
  • Size / Price
    List Price: $545.00  (Save $0.00)
    Price:$545.00      [How to order]
    Availsability:5 Business days
    • Human ErbB2 / HER2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged